Nieuwe manier van communiceren via internet... Echt kewl!

vbimport

#1

Dit is weer eens wat anders dan gewoon coderen van tekst. Zet het om in een lange DNA-string, je weet wel, waar ieder levend wezen uit opgebouwd is... >

Ga naar deze site: http://dna2z.com/DNA-o-gram/

en decodeer dit maar eens:
TTGATAAAGGCAATGAAGGTAATGGTTACAGTGGCTTCGATGACAAGCACGGCAATGGTGACAGCTTAGTAGTAG

Zeg maar eens wat je ervan vindt.

(Misschien een idee om hier een prog van te maken...)


#2

Dit is kewl, echt wel…

GrtZ mrDJ


#3

cool

wel fun dingetje hehe zou idd prog moeten zijn lol

Your DNA-o-gram
Your code was:
TTGATAAAGGCAATGAAGGTAATGGTTACAGTGGCTTCGATGACAAGCACGGCAATGGTGACAGCTTAGTAGTAG

Your DNA-o-gram reads:
Dit is kewl, echt wel…

TTGAGCTTGATATTGAAAGGCACAACCGTTGTAATGGGCGTCAGCGTTGTAATGACCGTAGTAATGTGTACAGGAACAGGCATGTAATAATAATAATAATAATAATAATAA

Decode die

[This message has been edited by Redneck (edited 11 May 2000).]


#4

ik vind dit uit de kunst, ZEEER verhelderend.
heb nog nooit iets duidelijker gelezen.


#5

GAAF MAN

Tnks