Nieuwe manier van communiceren via internet... Echt kewl!

Dit is weer eens wat anders dan gewoon coderen van tekst. Zet het om in een lange DNA-string, je weet wel, waar ieder levend wezen uit opgebouwd is… >

Ga naar deze site: http://dna2z.com/DNA-o-gram/

en decodeer dit maar eens:
TTGATAAAGGCAATGAAGGTAATGGTTACAGTGGCTTCGATGACAAGCACGGCAATGGTGACAGCTTAGTAGTAG

Zeg maar eens wat je ervan vindt.

(Misschien een idee om hier een prog van te maken…)

Dit is kewl, echt wel…

GrtZ mrDJ

cool

wel fun dingetje hehe zou idd prog moeten zijn lol

Your DNA-o-gram
Your code was:
TTGATAAAGGCAATGAAGGTAATGGTTACAGTGGCTTCGATGACAAGCACGGCAATGGTGACAGCTTAGTAGTAG

Your DNA-o-gram reads:
Dit is kewl, echt wel…

TTGAGCTTGATATTGAAAGGCACAACCGTTGTAATGGGCGTCAGCGTTGTAATGACCGTAGTAATGTGTACAGGAACAGGCATGTAATAATAATAATAATAATAATAATAA

Decode die

[This message has been edited by Redneck (edited 11 May 2000).]

ik vind dit uit de kunst, ZEEER verhelderend.
heb nog nooit iets duidelijker gelezen.

GAAF MAN

Tnks